View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1523_low_44 (Length: 281)

Name: NF1523_low_44
Description: NF1523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1523_low_44
NF1523_low_44
[»] chr5 (1 HSPs)
chr5 (62-265)||(8152516-8152719)


Alignment Details
Target: chr5 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 62 - 265
Target Start/End: Complemental strand, 8152719 - 8152516
Alignment:
Q  62 ttgaaaacaagagctacaaaagagggggttccgatggtggtcgtcaagactgaggatgtgtgggtggtaccattgaaaggattaaattgtggaacatcca 161  Q
    ||||||||||||||||||||||||||||||    | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  8152719 ttgaaaacaagagctacaaaagagggggtttttgttgtggtcgtcaagactgaggatgtgtgggtggtaccattgaaaggattaaattgtggaacatcca 8152620  T
Q  162 tggttgaagaaaatgaggagatgaggctgctaaataaagcaagagcattcccctcttgcagaaggaagaacccccggccgaagttaactcaacatcgttg 261  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
T  8152619 tggttgaagaaaatgaggagatgaggctgctaaataaagcaagagcattcccctcttgcagaaggaagaacccccgcccgaagttaactcaacatcgttg 8152520  T
Q  262 gtga 265  Q
    ||||    
T  8152519 gtga 8152516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University