View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1523_high_56 (Length: 237)

Name: NF1523_high_56
Description: NF1523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1523_high_56
NF1523_high_56
[»] chr2 (1 HSPs)
chr2 (1-221)||(16758452-16758672)


Alignment Details
Target: chr2 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 16758452 - 16758672
Alignment:
Q  1 gtttacacttaccttaatttgaagcagcaatcgaaaaagtttgtcaacacttgtcaaaatttctttatacccttttatggctgtcaccatttgctgcata 100  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
T  16758452 gtttacacttgccttaatttgaagcagcaatcgaaaaagtttgtcaacacttatcaaaatttctttatacccttttatggctgtcaccatttgctgcata 16758551  T
Q  101 tcgttatggagcctattcggctaccatgtttttgaactgaagcattttaaactttcacggttgaggattaagacagataaatgtattagccttgggaaat 200  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||| |||||||||||    
T  16758552 tcgttatggagcctattcggctaccatgtttttgaactgaagtattttaaactttcacggttggggattaagacagataaatgtattaaccttgggaaat 16758651  T
Q  201 gattgcgttcatgattgaatt 221  Q
    |||||| ||||||||||||||    
T  16758652 gattgcattcatgattgaatt 16758672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University