View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15239_low_16 (Length: 209)

Name: NF15239_low_16
Description: NF15239
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15239_low_16
NF15239_low_16
[»] chr5 (1 HSPs)
chr5 (18-150)||(5959973-5960105)


Alignment Details
Target: chr5 (Bit Score: 121; Significance: 3e-62; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 121; E-Value: 3e-62
Query Start/End: Original strand, 18 - 150
Target Start/End: Complemental strand, 5960105 - 5959973
Alignment:
Q  18 aaaatgggaagactatatacaagagtacacttggtgagaagacaattttactcgtctcgtaatagaaagtgacttcaagcttataattaatatagtttta 117  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
T  5960105 aaaatggggagactatatacaagagtacacttggtgagaagacaattttactcgtctcataatagaaagtgacttcaagcttataattaatatagtttta 5960006  T
Q  118 gaaaattgtaagcctattgaaaataatcatgta 150  Q
    ||||||||||||| |||||||||||||||||||    
T  5960005 gaaaattgtaagcttattgaaaataatcatgta 5959973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University