View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15237_low_33 (Length: 210)

Name: NF15237_low_33
Description: NF15237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15237_low_33
NF15237_low_33
[»] chr3 (1 HSPs)
chr3 (50-192)||(33762915-33763056)


Alignment Details
Target: chr3 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 50 - 192
Target Start/End: Complemental strand, 33763056 - 33762915
Alignment:
Q  50 aacatgaactaacacatgcatatgaacacagattttatggtnnnnnnnccgaaccttttgaaatggagtttggtcagattgtcaaactagttgagaccag 149  Q
    |||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||| ||||||||||||||||||||||||||    
T  33763056 aacatgaactaacacatgcatatgaacacagattttatggtaaaaaa-ccgaaccttttgaaatggagtttggccagattgtcaaactagttgagaccag 33762958  T
Q  150 atttatctgatgtatttctcagaagaacaaaattcgttgtgtg 192  Q
    |||||||||||||||||||||||||||||||||||||||||||    
T  33762957 atttatctgatgtatttctcagaagaacaaaattcgttgtgtg 33762915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University