View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15230_low_14 (Length: 245)

Name: NF15230_low_14
Description: NF15230
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15230_low_14
NF15230_low_14
[»] chr1 (3 HSPs)
chr1 (13-104)||(1386994-1387088)
chr1 (169-227)||(1387154-1387212)
chr1 (12-92)||(23698193-23698273)


Alignment Details
Target: chr1 (Bit Score: 81; Significance: 3e-38; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 13 - 104
Target Start/End: Original strand, 1386994 - 1387088
Alignment:
Q  13 gagatgaagagacgcaaagaaatattcaagatggagttggaactcatagagaagcataacagcactgcagcagg---taatattatacgcttaat 104  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||   ||||||||||||||||||    
T  1386994 gagatgaagagacgcaaagaaatattcaagatggagttggaactcatagagaagcataacagcactgcagcaggtaataatattatacgcttaat 1387088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 169 - 227
Target Start/End: Original strand, 1387154 - 1387212
Alignment:
Q  169 ccttccatttgcttgttttttcacaggttttacaattggcctaaatgaattttctgata 227  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  1387154 ccttccatttgcttgttttttcacaggttttacaattggcctaaatgaattttctgata 1387212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 12 - 92
Target Start/End: Complemental strand, 23698273 - 23698193
Alignment:
Q  12 tgagatgaagagacgcaaagaaatattcaagatggagttggaactcatagagaagcataacagcactgcagcaggtaatat 92  Q
    ||||||||| | |||||||||||||||||||| |   ||||||  |||||||||   ||||||||| || |||||||||||    
T  23698273 tgagatgaaaatacgcaaagaaatattcaagaagaccttggaatccatagagaactttaacagcacagctgcaggtaatat 23698193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University