View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15228_low_32 (Length: 238)

Name: NF15228_low_32
Description: NF15228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15228_low_32
NF15228_low_32
[»] chr7 (1 HSPs)
chr7 (117-221)||(2312796-2312900)


Alignment Details
Target: chr7 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 117 - 221
Target Start/End: Complemental strand, 2312900 - 2312796
Alignment:
Q  117 tctaacctcttgtcctctgagcttgccttcaatgtccaaaagtgtccctgtaagagccacagctaaggattgttttttcctattgattatgttatgtgta 216  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  2312900 tctaacctcttgtcctctgagtttgccttcaatgtccaaaagtgtccctgtaagagccacagctaaggattgttttttcctattgattatgttatgtgta 2312801  T
Q  217 tcata 221  Q
    |||||    
T  2312800 tcata 2312796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University