View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15228_low_25 (Length: 264)

Name: NF15228_low_25
Description: NF15228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15228_low_25
NF15228_low_25
[»] chr3 (2 HSPs)
chr3 (27-75)||(54495773-54495821)
chr3 (184-251)||(54495829-54495896)


Alignment Details
Target: chr3 (Bit Score: 49; Significance: 4e-19; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 27 - 75
Target Start/End: Original strand, 54495773 - 54495821
Alignment:
Q  27 tgaattagagagcatcctcactgtcatatcatcgccctgacttttcaac 75  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
T  54495773 tgaattagagagcatcctcactgtcatatcatcgccctgacttttcaac 54495821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 184 - 251
Target Start/End: Original strand, 54495829 - 54495896
Alignment:
Q  184 aatggaatgattcggtcannnnnnncttacaataaaaagcttctgctaatgaattgcatttgttattc 251  Q
    ||||||||||||||||||       |||||||||||||||||||||||||||||||||| ||||||||    
T  54495829 aatggaatgattcggtcatttttttcttacaataaaaagcttctgctaatgaattgcatctgttattc 54495896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University