View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15224_low_14 (Length: 241)

Name: NF15224_low_14
Description: NF15224
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15224_low_14
NF15224_low_14
[»] chr7 (1 HSPs)
chr7 (65-241)||(45082756-45082931)


Alignment Details
Target: chr7 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 65 - 241
Target Start/End: Complemental strand, 45082931 - 45082756
Alignment:
Q  65 atgactaaaaatcatacataattgcttaaatttacatgatgaggttgttttgctggtgtgtgtgagtaggcatgcaccagccttctattattacaatctg 164  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
T  45082931 atgactaaaaatcatacataattgcttaaatttacatgatgaggttgttttgctg-tgtgtgtgagtaggcatgcaccagccttctattattacaatctg 45082833  T
Q  165 gtattgatttatacagccagtgtcaatggttgagtactgtttttgctcatataggcaacaaattatagatagctagc 241  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
T  45082832 gtattgatttatacagccagtgtcaatggttgagcactgtttttgctcatataggcaacaaattatagatagctagc 45082756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University