View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15223_high_9 (Length: 222)

Name: NF15223_high_9
Description: NF15223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15223_high_9
NF15223_high_9
[»] chr3 (1 HSPs)
chr3 (99-210)||(51154218-51154328)


Alignment Details
Target: chr3 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 99 - 210
Target Start/End: Original strand, 51154218 - 51154328
Alignment:
Q  99 ttattcaagcaatccaaaccaagaaaataaacaataaccatcaaagtatgagatatcgattctatttcagtatagtgtaaatgtaatttcaaaattgttc 198  Q
    |||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  51154218 ttatccaagcaatccaaaccaagaaaataaacaataaccatcaa-gtatgagatatcgattctatttcagtatagtgtaaatgtaatttcaaaattgttc 51154316  T
Q  199 tttaggcgccta 210  Q
    ||||||||||||    
T  51154317 tttaggcgccta 51154328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University