View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1520_low_33 (Length: 216)

Name: NF1520_low_33
Description: NF1520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1520_low_33
NF1520_low_33
[»] chr4 (1 HSPs)
chr4 (19-199)||(30810434-30810614)


Alignment Details
Target: chr4 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 19 - 199
Target Start/End: Original strand, 30810434 - 30810614
Alignment:
Q  19 taggattggtgattggtattatgtttttggatgtatggcttcgaggcatatagatggagttagagagatacagagatacagcgagggcaaggtttacaga 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
T  30810434 taggattggtgattggtattatgtttttggatgtatggcttcgaggcatatagatggagttagagagatacagagatacagcgagggtaaggtttacaga 30810533  T
Q  119 aggaaagttttcaaaggtatcaagataaaccctaatatagaggaaactgttgtgaaagatgaaaatatccctactactatc 199  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
T  30810534 aggaaagttttcaaaggtatcaagataaaccctaatatagaggaaactgttttgaaagatgaaaatatccctactactatc 30810614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University