View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15205_high_34 (Length: 236)

Name: NF15205_high_34
Description: NF15205
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15205_high_34
NF15205_high_34
[»] chr4 (1 HSPs)
chr4 (5-221)||(9741102-9741318)


Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 5 - 221
Target Start/End: Original strand, 9741102 - 9741318
Alignment:
Q  5 gcatctatgtccgagtccagacccacgaaggttgttaaaattcgaagtatgcatagctatatctttggcgcgattgcatgctttttggcgaatagcagtg 104  Q
    ||||||| |||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  9741102 gcatctaagtccaagtccagacccacggaggttgttaaaattcgaagtatgcatagctatatctttggcgcgattgcatgctttttggcgaatagcagtg 9741201  T
Q  105 gtattggctctagtacttaattctttcactccatcacaacacaatgaggatggatctttcacaccacctgttaggtaatccaagcaatcagctagggtta 204  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  9741202 gtattggctctagtacttaattctttcactccatcacaacacaatgaggatggatctttcacaccacctgttaggtaatccaagcaatcagctagggtta 9741301  T
Q  205 ttttcaccagatcacat 221  Q
    |||||||||||||||||    
T  9741302 ttttcaccagatcacat 9741318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University