View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15201_low_5 (Length: 286)

Name: NF15201_low_5
Description: NF15201
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15201_low_5
NF15201_low_5
[»] chr8 (1 HSPs)
chr8 (18-132)||(34429145-34429259)
[»] chr5 (1 HSPs)
chr5 (18-131)||(33738416-33738529)


Alignment Details
Target: chr8 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 18 - 132
Target Start/End: Complemental strand, 34429259 - 34429145
Alignment:
Q  18 gagggtttcgatagagtgagaagatgaagttgaaggagcgtcagacgttcgttgtcggatgttgaaaggaagtgaggggatggaagggaaggggaaagat 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  34429259 gagggtttcgatagagtgagaagatgaagttgaaggagcgtcagacgttcgttgtcggatgttgaaaggaagtgaggggatggaagggaaggggaaagat 34429160  T
Q  118 tcttgttcgggaaga 132  Q
    |||||||||||||||    
T  34429159 tcttgttcgggaaga 34429145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 18 - 131
Target Start/End: Original strand, 33738416 - 33738529
Alignment:
Q  18 gagggtttcgatagagtgagaagatgaagttgaaggagcgtcagacgttcgttgtcggatgttgaaaggaagtgaggggatggaagggaaggggaaagat 117  Q
    |||||||| ||| ||||||||||| ||||||||||||| | |||| |||||||||||||| |||||||| |  || |||||||| ||||  |||||||||    
T  33738416 gagggttttgattgagtgagaagacgaagttgaaggagtgccagaggttcgttgtcggattttgaaagggaaggatgggatggatgggagagggaaagat 33738515  T
Q  118 tcttgttcgggaag 131  Q
    | ||||| ||||||    
T  33738516 tgttgtttgggaag 33738529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University