View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1519_high_76 (Length: 274)

Name: NF1519_high_76
Description: NF1519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1519_high_76
NF1519_high_76
[»] chr5 (3 HSPs)
chr5 (1-117)||(5116054-5116170)
chr5 (201-259)||(5115713-5115771)
chr5 (118-155)||(5115813-5115850)


Alignment Details
Target: chr5 (Bit Score: 109; Significance: 7e-55; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 109; E-Value: 7e-55
Query Start/End: Original strand, 1 - 117
Target Start/End: Complemental strand, 5116170 - 5116054
Alignment:
Q  1 agaaagtaaacccctctcggtcaaactgatcgacttgatgaatgttggatttacccacttcttccttaagcacgtccatgcaatgtttagtgaatggatc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||    
T  5116170 agaaagtaaacccctctcggtcaaactgatcgacttgatgaatgttggatttacccacttcttccttaagcgcgtgcatgcaatgtttagtgaatggatc 5116071  T
Q  101 acaagagcctaccatta 117  Q
    |||||||||||||||||    
T  5116070 acaagagcctaccatta 5116054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 201 - 259
Target Start/End: Complemental strand, 5115771 - 5115713
Alignment:
Q  201 caagaacattatatcccaccattgacagtggctagttatcactcttcaattttgaaagt 259  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
T  5115771 caagaacattgtatcccaccattgacagtggctagttatcactcttcaattttgaaagt 5115713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 118 - 155
Target Start/End: Complemental strand, 5115850 - 5115813
Alignment:
Q  118 taatttaatgcctgctgatttgcctctcgagctatcat 155  Q
    |||||||||||||||||||||||||||||||| |||||    
T  5115850 taatttaatgcctgctgatttgcctctcgagcaatcat 5115813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University