View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15198_low_8 (Length: 263)

Name: NF15198_low_8
Description: NF15198
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15198_low_8
NF15198_low_8
[»] chr4 (1 HSPs)
chr4 (52-249)||(28691642-28691830)


Alignment Details
Target: chr4 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 52 - 249
Target Start/End: Original strand, 28691642 - 28691830
Alignment:
Q  52 ttctttttccaaattggtactggtgagttaattcatcaatttagaacttaaaaactagtacacgtatactacagcaactaaagttacttgcctattgaaa 151  Q
    |||||||||||||||||||||||||||||   |||||||||||||||||||||||||||||||      ||| |||||||| ||||||||||||||||||    
T  28691642 ttctttttccaaattggtactggtgagtt---tcatcaatttagaacttaaaaactagtacac------tactgcaactaacgttacttgcctattgaaa 28691732  T
Q  152 ttgtcgattttaataggacgggtggcataaaaatctagcaggatatgatccatgtgcatcagattatactgcagcatacctaaataggccacaggttc 249  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
T  28691733 ttgtcaattttaataggacgggtggcataaaaatctagcaggatatgatccatgtgcatcagattatactgcagcatacctaaataggccagaggttc 28691830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University