View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15197_low_13 (Length: 244)

Name: NF15197_low_13
Description: NF15197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15197_low_13
NF15197_low_13
[»] chr1 (1 HSPs)
chr1 (11-244)||(8158649-8158882)


Alignment Details
Target: chr1 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 11 - 244
Target Start/End: Complemental strand, 8158882 - 8158649
Alignment:
Q  11 tggttctgatgatatgaatgtttctgcaaataccatgtctacaacaccgatacctgttgtctctgcttcaaaacctgcacagacttcaggattgccaaca 110  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  8158882 tggttctgatgatatgaatgtttctgcaaataccatatctacaacaccgatacctgttgtctctgcttcaaaacctgcacagacttcaggattgccaaca 8158783  T
Q  111 gcccctctacagtttgaaggaacacttggatggaaaggttcggctgccaccagtgcctttcgtcctgcatcacctcgtaaaaatgctgataatcagaaga 210  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  8158782 gcccctctacagtttgaaggaacacttggatggaaagggtcggctgccaccagtgcctttcgtcctgcatcacctcgtaaaaatgctgataatcagaaga 8158683  T
Q  211 atgtttctgctggtgggaactctgatatttccaa 244  Q
    ||||||||||||||||||||||||||||||||||    
T  8158682 atgtttctgctggtgggaactctgatatttccaa 8158649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University