View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15195_low_38 (Length: 292)

Name: NF15195_low_38
Description: NF15195
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15195_low_38
NF15195_low_38
[»] chr3 (2 HSPs)
chr3 (108-276)||(29571843-29572011)
chr3 (19-49)||(29572070-29572100)


Alignment Details
Target: chr3 (Bit Score: 165; Significance: 3e-88; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 108 - 276
Target Start/End: Complemental strand, 29572011 - 29571843
Alignment:
Q  108 gaactagaatttcatttggtattattattggaacttcttcagtgaataactcattcattagttccattgttgagtcaaaaattggtgtcataatttggtc 207  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  29572011 gaactagaatttcatttggtataattattggaacttcttcagtgaataactcattcattagttccattgttgagtcaaaaattggtgtcataatttggtc 29571912  T
Q  208 ttgttctttagcttcagttattgttgatgactcaaatgatgtttctggtttttgtggttccttgttttt 276  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  29571911 ttgttctttagcttcagttattgttgatgactcaaatgatgtttctggtttttgtggttccttgttttt 29571843  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 19 - 49
Target Start/End: Complemental strand, 29572100 - 29572070
Alignment:
Q  19 atcagggagaagcaagtcttcaaggaagtta 49  Q
    |||||||||||||||||||||||||||||||    
T  29572100 atcagggagaagcaagtcttcaaggaagtta 29572070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University