View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15192_low_39 (Length: 263)

Name: NF15192_low_39
Description: NF15192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15192_low_39
NF15192_low_39
[»] chr1 (2 HSPs)
chr1 (102-263)||(24620632-24620793)
chr1 (121-187)||(4745607-4745673)


Alignment Details
Target: chr1 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 102 - 263
Target Start/End: Original strand, 24620632 - 24620793
Alignment:
Q  102 caagttgcctagattccttactagtaacttgggatgggaaactgactacgaagtctctatttcaaggcaatcttgatgctcaaatgcgatgaagtaccaa 201  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  24620632 caagttgcctagattccttactagtaacttgtgatgggaaactgactacgaagtctctatttcaaggcaatcttgatgctcaaatgcgatgaagtaccaa 24620731  T
Q  202 tatagacaagacacgtgaacactagtaataaaatatgaaaatagaagtaagtgaatgtaatt 263  Q
    || |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
T  24620732 taaagacaagacatgtgaacactagtaataaaatatgaaaatagaagtaagtgaatgtaatt 24620793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 121 - 187
Target Start/End: Complemental strand, 4745673 - 4745607
Alignment:
Q  121 actagtaacttgggatgggaaactgactacgaagtctctatttcaaggcaatcttgatgctcaaatg 187  Q
    |||||||||||| |||||||||| |||||||||||| ||||||||||||| ||||| || |||||||    
T  4745673 actagtaacttgtgatgggaaaccgactacgaagtccctatttcaaggcattcttggtggtcaaatg 4745607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University