View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15192_low_33 (Length: 281)

Name: NF15192_low_33
Description: NF15192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15192_low_33
NF15192_low_33
[»] chr7 (1 HSPs)
chr7 (18-276)||(36571756-36572023)


Alignment Details
Target: chr7 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 18 - 276
Target Start/End: Complemental strand, 36572023 - 36571756
Alignment:
Q  18 agagatatcgagtagtcaaatgaaaatagttgaaaggtcgtttcagatcacaaactacagtttatccagcagaaggaagggtggtgaatgta---atgta 114  Q
    ||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||   |||||    
T  36572023 agagagatcgagtagtcaaatgaaaatagttgaaaggtcgtttctgatcacaaactacagtttatccagcagaaggaagggtggtgaatgtagtaatgta 36571924  T
Q  115 ttcatatcagtatatgttaccaatcaccctaaccaacacaaattgggctccacaatgcacactcccagttttcatttattc-----atttctacatatat 209  Q
    ||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||     ||||||||||||||    
T  36571923 ttcatatcagtatatgttaccaatcaccccaaccaacacaaattgggctccacattgcacactcccagttttcatttattcatttaatttctacatatat 36571824  T
Q  210 atttttcacc-ttttgcccatctctctcttataaagctgcaaacgagatctatccacttcatctcagt 276  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
T  36571823 atttttcacctttttgcccatctctctcttataaagctgcaaacgagatctatccacttcatcacagt 36571756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University