View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15192_low_16 (Length: 398)

Name: NF15192_low_16
Description: NF15192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15192_low_16
NF15192_low_16
[»] chr6 (1 HSPs)
chr6 (273-382)||(7212913-7213032)


Alignment Details
Target: chr6 (Bit Score: 77; Significance: 1e-35; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 273 - 382
Target Start/End: Original strand, 7212913 - 7213032
Alignment:
Q  273 acctccctcttcctttgtcgtgccacactgtaaaactctcatctctctcgtcctttgcctttg----------atgtccaatctccgccgccaaaagctt 362  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||          |||||| ||||||||||||||||||||    
T  7212913 acctccctcttcctttgtcgcgccacactgtaaaactctcatctctctcgtcctttgcctttgccacgaatttatgtccgatctccgccgccaaaagctt 7213012  T
Q  363 tgtttccggtcaccctcgtg 382  Q
    ||||||||||||||||||||    
T  7213013 tgtttccggtcaccctcgtg 7213032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University