View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15188_low_20 (Length: 246)

Name: NF15188_low_20
Description: NF15188
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15188_low_20
NF15188_low_20
[»] chr8 (2 HSPs)
chr8 (157-227)||(43017057-43017127)
chr8 (34-85)||(43017130-43017181)


Alignment Details
Target: chr8 (Bit Score: 67; Significance: 7e-30; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 157 - 227
Target Start/End: Complemental strand, 43017127 - 43017057
Alignment:
Q  157 tttttaaggatctatcacaacgattcaggtctcacatcaagtatattgaggattctacaaccacaatgtca 227  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
T  43017127 tttttaaggatctatcacaacgattcaggtctcacatcaagtatattgatgattctacaaccacaatgtca 43017057  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 34 - 85
Target Start/End: Complemental strand, 43017181 - 43017130
Alignment:
Q  34 actggaaagaacaggttgtgaatttaaagaaatcatggagtaaaagtagttc 85  Q
    ||||||||||||||||||||||||||||||||||||| ||||||| ||||||    
T  43017181 actggaaagaacaggttgtgaatttaaagaaatcatgaagtaaaaatagttc 43017130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University