View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15188_high_22 (Length: 234)

Name: NF15188_high_22
Description: NF15188
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15188_high_22
NF15188_high_22
[»] chr7 (1 HSPs)
chr7 (20-181)||(48842452-48842614)


Alignment Details
Target: chr7 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 20 - 181
Target Start/End: Complemental strand, 48842614 - 48842452
Alignment:
Q  20 gtatacgtaggtctgaaaagatagttaattgccattccccaacgaacgatcgttaactgctaccggagataaaatggtcagttcaagatgtataccatga 119  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||| ||||||||||||| ||||||||||||||||||||||    
T  48842614 gtatacgtaggtctgaaaagatagttaattgccgttccccaacgaacgatcgttaaccgctactggagataaaatggacagttcaagatgtataccatga 48842515  T
Q  120 gtgctaaacaacaaactttggtgtgtttttggat-gattgttcatcattcgtagaatgcgaga 181  Q
     ||||||||||||||||||||||||||||||||| |||||||||||  ||| | |||||||||    
T  48842514 ttgctaaacaacaaactttggtgtgtttttggatggattgttcatccctcggaaaatgcgaga 48842452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University