View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15183_low_24 (Length: 237)

Name: NF15183_low_24
Description: NF15183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15183_low_24
NF15183_low_24
[»] chr8 (1 HSPs)
chr8 (13-197)||(5397738-5397921)


Alignment Details
Target: chr8 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 13 - 197
Target Start/End: Complemental strand, 5397921 - 5397738
Alignment:
Q  13 ttagtgtcttgaatcagtataaaactacgtggatgtttgatatcaccgtgtcacattgactcacagagatttcgataaagctagagtgatactaaacatt 112  Q
    ||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||| ||| | ||||||||||||||    
T  5397921 ttagtgtcttagatcagtataaaactacgtggatgtttgatatcaccgtgtcacattgactcaccgtgatttcgataaacctaaa-tgatactaaacatt 5397823  T
Q  113 cactactattgctatttttgaatagggaatgggagatgaaggtggggtttaaggcttatgctctcacttgccttaagcttctcga 197  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  5397822 cactactattgctatttttgaatagggaatgggagatgaaggtggggtttaaggcttatgctctcacttgccttaagcttctcga 5397738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University