View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15182_high_97 (Length: 224)

Name: NF15182_high_97
Description: NF15182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15182_high_97
NF15182_high_97
[»] chr8 (1 HSPs)
chr8 (1-213)||(10505005-10505216)


Alignment Details
Target: chr8 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 213
Target Start/End: Original strand, 10505005 - 10505216
Alignment:
Q  1 cggtcaagtgataaaggttaaagaatgtgttggtgacttgggcggaagccatgcgcctccaagcatggaatgctaattttaggcaaatgattggcttatt 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
T  10505005 cggtcaagtgataaaggttaaagaatgtgttggtgacttgggcggaagccatgcacctccaagcatggaatgctaattttaggcaaatgattggcttatt 10505104  T
Q  101 agttggtgagttttgtaaacaagaaaacaaaaatagttggtgagttctaaaatactagacnnnnnnnnnagcaaaaaacactagacttgttgtgattaga 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||         | ||||||| |||||||||||||||||||||    
T  10505105 agttggtgagttttgtaaacaagaaaacaaaaatagttggtgagttataaaatactagac-ctttttttatcaaaaaatactagacttgttgtgattaga 10505203  T
Q  201 aaaatggtatatt 213  Q
    |||||||||||||    
T  10505204 aaaatggtatatt 10505216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University