View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15182_high_55 (Length: 313)

Name: NF15182_high_55
Description: NF15182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15182_high_55
NF15182_high_55
[»] chr2 (1 HSPs)
chr2 (123-303)||(2750920-2751100)


Alignment Details
Target: chr2 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 123 - 303
Target Start/End: Original strand, 2750920 - 2751100
Alignment:
Q  123 gagagtcttcctgagagtcttccttcatttggcatacttgtttacatttcaacatcacaataggccctttcaaaactcttagctttagaaaaattcacca 222  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  2750920 gagagtcttcctgagagtcttccttcatttggcatacttgtttacatttcaacatcacaataggccctttcaaaactcttagctttagaaaaattcacca 2751019  T
Q  223 acacaggtgaacaagatatctttagagtacggtgtcttgttttcaacaatccaaccttaaaccttatccttgctctgatga 303  Q
     ||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  2751020 gcacgggtgaacaagatatccttagagtacggtgtcttgttttcaacaatccaaccttaaaccttatccttgctctgatga 2751100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University