View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15179_low_6 (Length: 246)

Name: NF15179_low_6
Description: NF15179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15179_low_6
NF15179_low_6
[»] chr1 (1 HSPs)
chr1 (1-176)||(6695553-6695732)


Alignment Details
Target: chr1 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 1 - 176
Target Start/End: Original strand, 6695553 - 6695732
Alignment:
Q  1 attattgttttttggataaagagaatgctatgagtagcatgacc----ccaccggaaaggacaagttcaacaacttgacacatggaaagggatcaaattc 96  Q
    |||||| |||||||||||||||||||||||||||||||||||||    |||||||||||||||||||||||||||||||||||||||||||| |||||||    
T  6695553 attatttttttttggataaagagaatgctatgagtagcatgaccgaccccaccggaaaggacaagttcaacaacttgacacatggaaagggaccaaattc 6695652  T
Q  97 aaaatgggtggtacacatggtgtggggatgcaaactgacctcgtatgtttctacataatgcattcagacatattgttggt 176  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  6695653 aaaatgggtggtacacatggtgtggggatgcaaactgacctcgtatgtttctacataatgcattcagacatattgttggt 6695732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University