View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15178_low_65 (Length: 240)

Name: NF15178_low_65
Description: NF15178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15178_low_65
NF15178_low_65
[»] chr2 (2 HSPs)
chr2 (1-100)||(14488537-14488635)
chr2 (175-221)||(14488429-14488475)


Alignment Details
Target: chr2 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 1 - 100
Target Start/End: Complemental strand, 14488635 - 14488537
Alignment:
Q  1 aataattgtgaaattactgcatatcacaacttttcccttgataaatagaagtttttgagttatgtttaagaaagttggttttcaagatcttgaaatcttc 100  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||| |||||||||||||||||||||    
T  14488635 aataattttgaaattactgcatatcacaacttttcccttgataaatagaagtttttgagttatgtgcaagaaagttgg-tttcaagatcttgaaatcttc 14488537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 175 - 221
Target Start/End: Complemental strand, 14488475 - 14488429
Alignment:
Q  175 ggtttgtaaagggaaagaggaaaatctataaaaatataataatgtca 221  Q
    |||||||||||||||| ||||||||||||||||||||||||||||||    
T  14488475 ggtttgtaaagggaaaaaggaaaatctataaaaatataataatgtca 14488429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University