View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15178_high_50 (Length: 251)

Name: NF15178_high_50
Description: NF15178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15178_high_50
NF15178_high_50
[»] chr7 (1 HSPs)
chr7 (57-137)||(25113163-25113243)


Alignment Details
Target: chr7 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 57 - 137
Target Start/End: Complemental strand, 25113243 - 25113163
Alignment:
Q  57 tgcattaagtatagtatgaatttcatcgatatcaattgtgttgttgatttagttacttacaatcataataaaaacgatttt 137  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  25113243 tgcattaagtatagtatgaatttcatcgatatcaattgtgttgttgatttagttacttacaatcataataaaaacgatttt 25113163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University