View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1516_low_60 (Length: 229)

Name: NF1516_low_60
Description: NF1516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1516_low_60
NF1516_low_60
[»] chr1 (1 HSPs)
chr1 (19-218)||(48097419-48097622)


Alignment Details
Target: chr1 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 19 - 218
Target Start/End: Complemental strand, 48097622 - 48097419
Alignment:
Q  19 agcatgatcaaatgtaacatggagacaacctctttcaacaataattctatatatggggtacaacatgtgctttagagaatcttcagggtgcacattcttg 118  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| || ||||||||||||    
T  48097622 agcacgatcaaatgtaacatggagacaacctctttcaacaataattctatatatgaggtacaacatgtgctttagagaatcttcgggatgcacattcttg 48097523  T
Q  119 gcaaat-ataatatttctacttctttgtcactcttctagaagctgaaaccatagactt---gggagctatcaaagtggtcatatcaaactaaatgaatgt 214  Q
    |||||| ||||||||||||||||||||||||||||||||||||| |||||||||| ||   || |||||||||||||||||||||||||| |||||||||    
T  48097522 gcaaatcataatatttctacttctttgtcactcttctagaagctaaaaccatagatttgcgggaagctatcaaagtggtcatatcaaactgaatgaatgt 48097423  T
Q  215 tgtt 218  Q
    ||||    
T  48097422 tgtt 48097419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University