View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1516_low_47 (Length: 246)

Name: NF1516_low_47
Description: NF1516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1516_low_47
NF1516_low_47
[»] chr8 (2 HSPs)
chr8 (151-231)||(35628961-35629042)
chr8 (1-84)||(35629109-35629197)


Alignment Details
Target: chr8 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 151 - 231
Target Start/End: Complemental strand, 35629042 - 35628961
Alignment:
Q  151 gtactgtactatctcttccttcatagtttgacttacagatgttaaatcaatattgtgc-atatgatgtcaattaatatgaat 231  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||    
T  35629042 gtactgtactatctcttccttcatagtttgacttacatatgttaaatcaatattgtgcaatatgatgtcaattaatatgaat 35628961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 1 - 84
Target Start/End: Complemental strand, 35629197 - 35629109
Alignment:
Q  1 tggaagtgacaatgtattgtccttctatagttcttttgttttcttcttaatttcaaata-----atccgtatctgtttacgtgatagtg 84  Q
    ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||     ||||||||| |||||||||||||||    
T  35629197 tggaagtgacaatgtattgtccttctataattcttttgttttcttcttaatttcaaataatccaatccgtatcagtttacgtgatagtg 35629109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University