View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1516_low_29 (Length: 334)

Name: NF1516_low_29
Description: NF1516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1516_low_29
NF1516_low_29
[»] chr8 (2 HSPs)
chr8 (264-334)||(42959588-42959657)
chr8 (120-160)||(42959764-42959804)


Alignment Details
Target: chr8 (Bit Score: 59; Significance: 6e-25; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 264 - 334
Target Start/End: Complemental strand, 42959657 - 42959588
Alignment:
Q  264 gatttaatgaaaaagcctacgtttcgcaatgaattaatgtttggatctcggttgatagaattattgatttt 334  Q
    ||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||    
T  42959657 gatttaatgaaaaagcctatgtttcg-aatgaattaatgtttggatctcggttgatagaattattgatttt 42959588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 120 - 160
Target Start/End: Complemental strand, 42959804 - 42959764
Alignment:
Q  120 aggtggctgcgtggtggaacagcacgcatggcacgtgtgca 160  Q
    |||||||||||||||||||||||||||||||||||||||||    
T  42959804 aggtggctgcgtggtggaacagcacgcatggcacgtgtgca 42959764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University