View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15169_low_19 (Length: 218)

Name: NF15169_low_19
Description: NF15169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15169_low_19
NF15169_low_19
[»] chr8 (1 HSPs)
chr8 (19-193)||(2255872-2256046)


Alignment Details
Target: chr8 (Bit Score: 107; Significance: 8e-54; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 19 - 193
Target Start/End: Original strand, 2255872 - 2256046
Alignment:
Q  19 aattaagtctaactcatatttataaaacctaaaccattcgtaaactcatacttataaaaccatttgtaaggcgaagaatgtttaatctaannnnnnnnca 118  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||| | | ||||||        ||    
T  2255872 aattgagtctaactcatatttataaaacctaaaccattcgtaaactcatacttataaaaccatttgtaaagcaaagaatatctgatctaattttttttca 2255971  T
Q  119 atacatcatctcacgaccaacacgactaacttaatgggtgtatataaatgatgaatgacctgatcattatgctct 193  Q
    ||||||||||| |||||||||||||||||||| ||| ||| ||||||||||| ||||||||||||||||||||||    
T  2255972 atacatcatcttacgaccaacacgactaacttgatgcgtgcatataaatgataaatgacctgatcattatgctct 2256046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University