View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15167_low_42 (Length: 217)

Name: NF15167_low_42
Description: NF15167
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15167_low_42
NF15167_low_42
[»] chr4 (1 HSPs)
chr4 (13-195)||(21023865-21024047)


Alignment Details
Target: chr4 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 13 - 195
Target Start/End: Original strand, 21023865 - 21024047
Alignment:
Q  13 ataattctagtggtgttgatgagaggtcataagtttgatcccttcaaaagcctacaagatatccaatattcatccaaatacgaatttaggggccaccatt 112  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  21023865 ataattctagtggtgttgatgagaggtcataagtttgatcccttgaaaagcctacaagatatccaatattcatccaaatacgaatttaggggccaccatt 21023964  T
Q  113 gggtcacaattttcagatattaggagcattactttgccggccggctaatatagcaatttagaatgaggggatggtgccttagt 195  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||    
T  21023965 gggtcacaattttcagatattaggagcagtactttgccggccggctaatatagtaatttagaatgaggggatggtgccttagt 21024047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University