View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15167_low_39 (Length: 238)

Name: NF15167_low_39
Description: NF15167
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15167_low_39
NF15167_low_39
[»] chr8 (1 HSPs)
chr8 (1-223)||(34426398-34426620)


Alignment Details
Target: chr8 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 34426620 - 34426398
Alignment:
Q  1 gaactgagactgtctttttggnnnnnnnnngttgctttgaatttgaggtactattttgtttcattgttatgcagtcttctataaacagtgaggtggatga 100  Q
    |||||||||||||||||||||         ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
T  34426620 gaactgagactgtctttttggtttttttttgttgctttgaatttgaggtcctattttgtttcattgttatgcagtcttctataaacagtgaggtggatga 34426521  T
Q  101 aattttgtctgtttattgtttgtgggatatatttgattcttttagtgtctgccaatccatgtcttattttaatgaatgcgctcacttgttatggagttgc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  34426520 aattttgtctgtttattgtttgtgggatatatttgattcttttagtgtctgccaatccatgtcttattttaatgaatgcgctcacttgttatggagttgc 34426421  T
Q  201 ttaactcactttctgtcgtttat 223  Q
    |||||||||||||||||||||||    
T  34426420 ttaactcactttctgtcgtttat 34426398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University