View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15167_low_27 (Length: 298)

Name: NF15167_low_27
Description: NF15167
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15167_low_27
NF15167_low_27
[»] chr4 (2 HSPs)
chr4 (243-298)||(24994710-24994765)
chr4 (9-98)||(24994909-24994998)


Alignment Details
Target: chr4 (Bit Score: 52; Significance: 8e-21; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 243 - 298
Target Start/End: Complemental strand, 24994765 - 24994710
Alignment:
Q  243 gtcatacacataagtatcaataaaacaacaaccaacaaaatattgtaaaaacattt 298  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  24994765 gtcatacacataagtagcaataaaacaacaaccaacaaaatattgtaaaaacattt 24994710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 9 - 98
Target Start/End: Complemental strand, 24994998 - 24994909
Alignment:
Q  9 atgaataaaaataagatacgatagtgagatgaaaaa-ttaatacatatatttttcaaggatnnnnnnntaagtttcatatttttaattgac 98  Q
    |||||||||||||||||| ||||||||||| ||||| |||||| |||||||||||||| ||       ||| |||||||||||||||||||    
T  24994998 atgaataaaaataagata-gatagtgagattaaaaaattaatatatatatttttcaagaataaaaaattaattttcatatttttaattgac 24994909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University