View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15167_low_26 (Length: 298)

Name: NF15167_low_26
Description: NF15167
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15167_low_26
NF15167_low_26
[»] chr1 (2 HSPs)
chr1 (161-283)||(40865568-40865691)
chr1 (23-131)||(40865400-40865508)


Alignment Details
Target: chr1 (Bit Score: 104; Significance: 7e-52; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 104; E-Value: 7e-52
Query Start/End: Original strand, 161 - 283
Target Start/End: Original strand, 40865568 - 40865691
Alignment:
Q  161 tataaatatatat-tattattctgcaccttgatttgtagcttggtattgttataagttgcactttgtttttcccgttgtcacaattcatgcattgccatg 259  Q
    |||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
T  40865568 tatatatatatatatattattctgcaccttgatttgtagcttggtattgttataagttgcactttgttttttccgttgtcacaattcatgcattgccatg 40865667  T
Q  260 tctttgtcgtctcttccctctgtg 283  Q
    ||||||||||||||||||| ||||    
T  40865668 tctttgtcgtctcttccctttgtg 40865691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 23 - 131
Target Start/End: Original strand, 40865400 - 40865508
Alignment:
Q  23 tctaggagaagatccgccgctgagcccaggctcgccggacggtaaatctgcccatgcttaataggttctagccacttatcagtgtctcttattttttgta 122  Q
    |||||||||| ||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||| || | |||||||||||||||||    
T  40865400 tctaggagaaaatccgccgctgagcccaggctcgccaggcggtaaatctgcccatgcttaataggttctagccacttgtctgcgtctcttattttttgta 40865499  T
Q  123 tggttgcct 131  Q
    |||||||||    
T  40865500 tggttgcct 40865508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University