View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15167_low_20 (Length: 337)

Name: NF15167_low_20
Description: NF15167
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15167_low_20
NF15167_low_20
[»] chr7 (2 HSPs)
chr7 (185-318)||(35159530-35159663)
chr7 (1-111)||(35159737-35159850)


Alignment Details
Target: chr7 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 185 - 318
Target Start/End: Complemental strand, 35159663 - 35159530
Alignment:
Q  185 aagcacctgagaaaccatgtctcaaatgcatcaaccatcaaactcaataaaccatcacagtaacatatattgttttgggatgtagtacatgcttcgagtt 284  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||    
T  35159663 aagcacgtgagaaaccatgtctcaaatgcatcaaccatcaaactcaataaaccatcaaaataacatatattgttttgggatgtagtacatgcttcgagtt 35159564  T
Q  285 tttctcaacttgataatactcctacggtcatatt 318  Q
    ||||||||||||||||||||||||||||||||||    
T  35159563 tttctcaacttgataatactcctacggtcatatt 35159530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 1 - 111
Target Start/End: Complemental strand, 35159850 - 35159737
Alignment:
Q  1 atgttccgtcataagacacatcaccaccaccggacaaagttgatatgagatttggtgg---tggttcttctcataaaccactaccgctgaatttgatatt 97  Q
    |||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||   |||||||||| |||||||||| |||||||||||||||||    
T  35159850 atgttccgccataagacacatcaccaccacgggacaaagttgatatgagatttggtggtggtggttcttctgataaaccactgccgctgaatttgatatt 35159751  T
Q  98 gattgcataagtaa 111  Q
    ||||||||||||||    
T  35159750 gattgcataagtaa 35159737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University