View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15165_low_11 (Length: 247)

Name: NF15165_low_11
Description: NF15165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15165_low_11
NF15165_low_11
[»] chr1 (1 HSPs)
chr1 (1-148)||(49736397-49736544)


Alignment Details
Target: chr1 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 1 - 148
Target Start/End: Complemental strand, 49736544 - 49736397
Alignment:
Q  1 ggtagaagaattcccagtaaggttagttagnnnnnnncttcagtttcatattacatttcaattattattgctttgataataattcaattgaatcataaaa 100  Q
    |||||||||||||| |||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  49736544 ggtagaagaattcctagtaaggttagttagtttttttcttcagtttcatattacatttcaattattattgctttgataataattcaattgaatcataaaa 49736445  T
Q  101 gatatttagctctgtgaattgtgatatttgaagctctgcaaattgctt 148  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||    
T  49736444 gatatttagctctgtgaattctgatatttgaagctctgcaaattgctt 49736397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University