View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15163_low_61 (Length: 341)

Name: NF15163_low_61
Description: NF15163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15163_low_61
NF15163_low_61
[»] chr5 (1 HSPs)
chr5 (23-291)||(28047526-28047795)


Alignment Details
Target: chr5 (Bit Score: 162; Significance: 2e-86; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 23 - 291
Target Start/End: Complemental strand, 28047795 - 28047526
Alignment:
Q  23 atattctaaggtaggatagactttctaataaattaggaattcttgatgaaactttgcgtagttttgatacat-taatgtttgattgggtttaattttggc 121  Q
    ||||||||| ||||||||| |||| |||||| ||| ||||||| |||||| ||||||||||||| |||| || ||||||||| |||||  ||| |||||     
T  28047795 atattctaatgtaggatagcctttataataacttacgaattctggatgaagctttgcgtagtttagataaatgtaatgtttggttgggcataagtttggt 28047696  T
Q  122 tttgcacttctttgtattgctattagtaggttgatcagatggattccattttgggattactgaatactgaattaacaacaataaaaccaaacacagaatt 221  Q
    |||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||| ||||||  ||| ||||| |||| | ||||||||    
T  28047695 tttgcacttctttgtattgctattagtaggtaaatcagatggattccattttgggattactgaatattgaattcgcaataataataccagaaacagaatt 28047596  T
Q  222 tgttgtgactgataaatcattgattttagttgttacttttggatcttaccaacttcagattctataagga 291  Q
    || |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  28047595 tgatgtgactgatgaatcattgattttagttgttacttttggatcttaccaacttcagattctataagga 28047526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University