View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15163_high_135 (Length: 202)

Name: NF15163_high_135
Description: NF15163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15163_high_135
NF15163_high_135
[»] chr1 (2 HSPs)
chr1 (1-186)||(9376221-9376406)
chr1 (18-76)||(9237714-9237772)


Alignment Details
Target: chr1 (Bit Score: 165; Significance: 2e-88; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 186
Target Start/End: Complemental strand, 9376406 - 9376221
Alignment:
Q  1 gaaattgaattcgaacttttccacatttttcagtgcatggatttttggatgttactggttctgttaatagaagaaagaacatagttagtagaaaggcgaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  9376406 gaaattgaattcgaacttttccacatttttcagtgcatggatttttggatgttactggttctgttaatagaagaaagaacatagttagtagaaaggcgaa 9376307  T
Q  101 attgtgaaaattggccannnnnnngtatgattttgcaggtttaggtttaggttgttgttatagtttgagtatgaggaaccttgttt 186  Q
    |||||||||||||||||       ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  9376306 attgtgaaaattggccatttttttgtatgattttgcaggtttaggtttaggttgttgttatagtttgagtatgaggaaccttgttt 9376221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 18 - 76
Target Start/End: Original strand, 9237714 - 9237772
Alignment:
Q  18 tttccacatttttcagtgcatggatttttggatgttactggttctgttaatagaagaaa 76  Q
    ||||||||||||||||||||| ||||||||||||||||||||| |||||| || |||||    
T  9237714 tttccacatttttcagtgcattgatttttggatgttactggttttgttaacaggagaaa 9237772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University