View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15163_high_131 (Length: 227)

Name: NF15163_high_131
Description: NF15163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15163_high_131
NF15163_high_131
[»] chr8 (1 HSPs)
chr8 (21-216)||(23985348-23985543)


Alignment Details
Target: chr8 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 21 - 216
Target Start/End: Original strand, 23985348 - 23985543
Alignment:
Q  21 acatgcaaacatttgtattgcgatagaaaatatagacaaatgcatatgttgcgacggtaagttgtggaccgcaatttagaactatgatagtagtaatata 120  Q
    ||||||||||||||| |||| ||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||| ||| |||||||||||||||||    
T  23985348 acatgcaaacatttggattgagatagaaaatatagacaaatgcatacgttgcgacggtaagttgtgaaccgcaatttaaaaccatgatagtagtaatata 23985447  T
Q  121 atagtgatttagaagaccatgaagttcatgtcaaatcctagagttcaactggcttaattagcttagaaatactttcatcccatcgtttcatctcac 216  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||    
T  23985448 atagtgatttagaagaccatgaagttcatgtcaaatcctagagttcaactggcttaattagcttagaaaaactttcatcccatcgtttcatgtcac 23985543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University