View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15163_high_118 (Length: 247)

Name: NF15163_high_118
Description: NF15163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15163_high_118
NF15163_high_118
[»] chr8 (1 HSPs)
chr8 (202-233)||(3946923-3946954)


Alignment Details
Target: chr8 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 202 - 233
Target Start/End: Original strand, 3946923 - 3946954
Alignment:
Q  202 gctctttttggatcaacctcagaagaggtaaa 233  Q
    ||||||||||||||||||||||||||||||||    
T  3946923 gctctttttggatcaacctcagaagaggtaaa 3946954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University