View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15156_low_14 (Length: 245)

Name: NF15156_low_14
Description: NF15156
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15156_low_14
NF15156_low_14
[»] chr2 (2 HSPs)
chr2 (52-132)||(14460218-14460298)
chr2 (180-244)||(14460129-14460193)


Alignment Details
Target: chr2 (Bit Score: 81; Significance: 3e-38; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 52 - 132
Target Start/End: Complemental strand, 14460298 - 14460218
Alignment:
Q  52 ctcagagaaacatgaccattgaaattcctcgatttgtagtaaattcatagacttctgatcgcggttcctcatgtttcattt 132  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  14460298 ctcagagaaacatgaccattgaaattcctcgatttgtagtaaattcatagacttctgatcgcggttcctcatgtttcattt 14460218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 180 - 244
Target Start/End: Complemental strand, 14460193 - 14460129
Alignment:
Q  180 actagaactgatttgattaattgattaagtttgggttatggttttcccttgtccaagaattatct 244  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  14460193 actagaactgatttgattaattgattaagtttgggttatggttttcccttgtccaagaattatct 14460129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University