View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15151_low_4 (Length: 223)

Name: NF15151_low_4
Description: NF15151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15151_low_4
NF15151_low_4
[»] chr4 (1 HSPs)
chr4 (19-182)||(23094860-23095023)


Alignment Details
Target: chr4 (Bit Score: 87; Significance: 7e-42; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 19 - 182
Target Start/End: Complemental strand, 23095023 - 23094860
Alignment:
Q  19 cttttatcggaagcctaaagcaatggatttagtagctttacccttagtacgacctaactnnnnnnngaaggatcatgacaacttaagtttgtatttagtt 118  Q
    ||||||||||||||||||||| |||| ||||||||||||||| ||||||| ||| ||||       |||||||||||| ||||| |  ||||||| ||||    
T  23095023 cttttatcggaagcctaaagcgatgggtttagtagctttacctttagtacaacccaactaaaaat-gaaggatcatgataactttaagttgtattgagtt 23094925  T
Q  119 tgaatttaagattgtttgagtaattggacaaa-cgggagtatggaaaatgacaacaacggaaaaa 182  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||    
T  23094924 tgaatttaagattgtttgagtaattggacaaaccgggagtatggaaaatgaaaacaacggaaaaa 23094860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University