View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15146_high_22 (Length: 254)

Name: NF15146_high_22
Description: NF15146
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15146_high_22
NF15146_high_22
[»] chr1 (2 HSPs)
chr1 (16-134)||(6495743-6495861)
chr1 (169-244)||(6495896-6495971)


Alignment Details
Target: chr1 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 16 - 134
Target Start/End: Original strand, 6495743 - 6495861
Alignment:
Q  16 gttcttgcttgtgggaggcttgcaagtgttttgttccttttgctgtctgatttttggcagtcgtgttgctgctactgtgatgcagcctgcgcttttggcc 115  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||| |||||||||    
T  6495743 gttcttgcttgtgggaggcttgcaagtgttttgttccttttgctgtctgattgttggcagtcgtgttgctgttactgtgatgcagcctgcacttttggcc 6495842  T
Q  116 tgtagctgttacatattca 134  Q
    |||||||||||||| ||||    
T  6495843 tgtagctgttacattttca 6495861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 169 - 244
Target Start/End: Original strand, 6495896 - 6495971
Alignment:
Q  169 agtcctctccgtgttggatttggactcttaggggttttttgatcgagtttgtttgtagtagtgtgctgcggtctgt 244  Q
    |||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||    
T  6495896 agtcctctccgtgttggatttggactcttagggggttttttatcgagtttgtttgtagtagtgtgctgcggtctgt 6495971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University