View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15142_high_2 (Length: 237)

Name: NF15142_high_2
Description: NF15142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15142_high_2
NF15142_high_2
[»] chr3 (1 HSPs)
chr3 (18-220)||(28604363-28604565)
[»] chr5 (2 HSPs)
chr5 (110-155)||(32425704-32425749)
chr5 (25-67)||(32425888-32425930)


Alignment Details
Target: chr3 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 18 - 220
Target Start/End: Complemental strand, 28604565 - 28604363
Alignment:
Q  18 atgtataagaattgcatctacatcttcttttgtacagcttgaagttctcatacccattaaatcagctccttcaatactagtatttttctcactttcatca 117  Q
    |||||||||||||||||| ||||||||||| |||||| |||||||||||||||||||||| ||||||||||||||||||| |||||||||||| ||||||    
T  28604565 atgtataagaattgcatccacatcttctttagtacagtttgaagttctcatacccattaactcagctccttcaatactagaatttttctcactgtcatca 28604466  T
Q  118 tggctctttctatgtttgatgataaaaatctcttttttaacttgccctttatgtttttccactgaatcatcatcatgtttttctagtgctttcttcagct 217  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
T  28604465 tggctctttctgtgtttgatgataaaaatctcttttttaacttgccctttatgtttttctactgaatcatcatcatgtttttctagtgctttcttcagct 28604366  T
Q  218 tca 220  Q
    |||    
T  28604365 tca 28604363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 110 - 155
Target Start/End: Complemental strand, 32425749 - 32425704
Alignment:
Q  110 tttcatcatggctctttctatgtttgatgataaaaatctctttttt 155  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||    
T  32425749 tttcatcatggctttttctatgtttgatgataaaaatctctttttt 32425704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 25 - 67
Target Start/End: Complemental strand, 32425930 - 32425888
Alignment:
Q  25 agaattgcatctacatcttcttttgtacagcttgaagttctca 67  Q
    ||||||||||| || |||||||| |||||||||||||||||||    
T  32425930 agaattgcatcaacttcttctttagtacagcttgaagttctca 32425888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University