View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15140_high_6 (Length: 266)

Name: NF15140_high_6
Description: NF15140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15140_high_6
NF15140_high_6
[»] chr2 (1 HSPs)
chr2 (16-266)||(4706387-4706637)


Alignment Details
Target: chr2 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 16 - 266
Target Start/End: Original strand, 4706387 - 4706637
Alignment:
Q  16 aacttgccttgcgtcctacgacggatggctgcttgtctttcgccatgattcattgtttttcttttgccccttctctggagcaaaaatacaacttccgaat 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  4706387 aacttgccttgcgtcctacgacggatggctgcttgtctttcgccatgattcattgtttttcttttgccccttctctggagcaaaaatacaacttccgaat 4706486  T
Q  116 tgtccattgacaaaatcacatgactatattgcagcaatttcatctgctcccacatctcaggattgtattgttgtcgtgctcgatcgccccaatcattttc 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  4706487 tgtccattgacaaaatcacatgactatattgcagcaatttcatctgctcccacatctcaggattgtattgttgtcgtgctcgatcgccccaatcattttc 4706586  T
Q  216 aatttgaactgcacacactttgtcggggagaggatatatgggttaaatacc 266  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||    
T  4706587 aatttgaactgcacacactttgtcggggagatgatatatgggttaaatacc 4706637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University