View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1513_low_16 (Length: 214)

Name: NF1513_low_16
Description: NF1513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1513_low_16
NF1513_low_16
[»] chr5 (1 HSPs)
chr5 (18-198)||(18297620-18297800)


Alignment Details
Target: chr5 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 18 - 198
Target Start/End: Original strand, 18297620 - 18297800
Alignment:
Q  18 atgcgcctccataaaccactggtagggcggtgtaacaaacttcaatcctcacctcatgaaaaaagaatgaaacttagacatacaatagtgatttgcactc 117  Q
    ||||||||||||||||||| |||| ||||||||||||  ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
T  18297620 atgcgcctccataaaccaccggtaaggcggtgtaacaggcttcaatcctcacctcatgaaaaaagattgaaacttagacatacaatagtgatttgcactc 18297719  T
Q  118 atcatgataaccaaccgcggcaaagccgacggtttaatgagaagaggtggtgatgccgagggcgagttcaccacccatgtg 198  Q
    ||||||||||||||||||||||||||||  |||||||||||||||||||||||| ||||||||||||||||||||||||||    
T  18297720 atcatgataaccaaccgcggcaaagccgggggtttaatgagaagaggtggtgataccgagggcgagttcaccacccatgtg 18297800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University