View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15135_low_25 (Length: 205)

Name: NF15135_low_25
Description: NF15135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15135_low_25
NF15135_low_25
[»] chr1 (2 HSPs)
chr1 (11-191)||(28861319-28861498)
chr1 (92-191)||(28859377-28859476)
[»] chr7 (1 HSPs)
chr7 (141-174)||(2768165-2768198)


Alignment Details
Target: chr1 (Bit Score: 133; Significance: 2e-69; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 11 - 191
Target Start/End: Original strand, 28861319 - 28861498
Alignment:
Q  11 agtgaaaagaatcaacggttcttttggagtggttatcacatacattttctctcttccctctttttgaatgatctggttctggttgatcggtttggaaaag 110  Q
    |||||||| |||||||||||| ||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||| ||| |||||    
T  28861319 agtgaaaataatcaacggttcatttggagtggttatcacataccttttctctctcccctctttttgaatgatctggttctggttgatcggattgtaaaag 28861418  T
Q  111 caggaggattgttgatgctttggaaacttgtgttgcctcttggttggaagcttctccttagttttgaacaggtactttttg 191  Q
    |||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||| |||||||| |||| |||||    
T  28861419 caggaggattgttgatgctttggagatttgtgttgcctcttggttggaagcttctccttag-tttgaacatgtacattttg 28861498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 92 - 191
Target Start/End: Original strand, 28859377 - 28859476
Alignment:
Q  92 gttgatcggtttggaaaagcaggaggattgttgatgctttggaaacttgtgttgcctcttggttggaagcttctccttagttttgaacaggtactttttg 191  Q
    ||||||||||||||| ||||||||| ||| || |||||||||| ||||||||||||||||||||||||||||||||||  ||||||||||||||||||||    
T  28859377 gttgatcggtttggagaagcaggagaattttttatgctttggagacttgtgttgcctcttggttggaagcttctccttgattttgaacaggtactttttg 28859476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 141 - 174
Target Start/End: Complemental strand, 2768198 - 2768165
Alignment:
Q  141 tgttgcctcttggttggaagcttctccttagttt 174  Q
    ||||||||||||||||||||||||| ||||||||    
T  2768198 tgttgcctcttggttggaagcttcttcttagttt 2768165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University