View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15135_low_23 (Length: 215)

Name: NF15135_low_23
Description: NF15135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15135_low_23
NF15135_low_23
[»] chr4 (1 HSPs)
chr4 (14-199)||(35181473-35181657)


Alignment Details
Target: chr4 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 14 - 199
Target Start/End: Original strand, 35181473 - 35181657
Alignment:
Q  14 aattctcaaccagatcttcaacattatagaattcaattcaacaatgaaagaagatattgtgaattgatttagcaaactttgggcctatatggtttctcca 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
T  35181473 aattctcaaccagatcttcaacattatagaattcaattcaacaatgaaagaagatattgtgaattgatttagcaacctttgggcctatatggtttctcca 35181572  T
Q  114 cgtattaggaaggcatatgttggactgttgaatgatcttgatatttttgtttcaattgagaagtggagaacgacgaatttgattcc 199  Q
    ||||||||||||| |||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
T  35181573 cgtattaggaaggaatatgttggactattgtatgatcttgatatttttgtttcaattgagaagtggagaacgac-aatttgattcc 35181657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University