View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15135_low_17 (Length: 274)

Name: NF15135_low_17
Description: NF15135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15135_low_17
NF15135_low_17
[»] chr4 (1 HSPs)
chr4 (85-205)||(25226353-25226473)
[»] chr3 (1 HSPs)
chr3 (20-90)||(24733804-24733874)


Alignment Details
Target: chr4 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 85 - 205
Target Start/End: Original strand, 25226353 - 25226473
Alignment:
Q  85 tctctctcatgagaaagttagttacgatccataaccgtttccgcaatttatgcttgttcttcaagcttttccagttttcgtttttcccttgttttcttga 184  Q
    |||||||||||||| |||||||||||||||||||  ||||| |  ||| |||||||||||||||||||||||||||||||||||||| ||||||||||||    
T  25226353 tctctctcatgagagagttagttacgatccataattgtttctgtcattgatgcttgttcttcaagcttttccagttttcgtttttccgttgttttcttga 25226452  T
Q  185 agattccatgtgattcttctt 205  Q
    ||||||| |||||||||||||    
T  25226453 agattccttgtgattcttctt 25226473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 20 - 90
Target Start/End: Original strand, 24733804 - 24733874
Alignment:
Q  20 ttctttcatcaataatatgattctatttctgttattcataatatggtatcagttttattttgctttctctc 90  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  24733804 ttctttcatcaataatatgattctatttctgttattcataatatggtatcagttttattttgctttctctc 24733874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University